Journal: The Journal of biological chemistry

Article Title: Structural Characterization of the Active Site of the PduO-Type ATP:Co(I)rrinoid Adenosyltransferase from Lactobacillus reuteri

doi: 10.1074/jbc.M609557200

Figure Lengend Snippet: Strains and plasmids Unless otherwise stated, strains were constructed during the course of these studies.

Article Snippet: The N-terminal amino acid sequence of this construct is MSYYHHHHHHDYDIPTS ENLYFQG ASAPM 1 V 2 … where the location of the TEV protease cleavage site is underlined. table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Genotype Source or Ref. Plasmids pET-15b bla + Novagen pCOBA17 pET15b cobA se + bla + Escalante-Semerena lab collection pPDU19 pET28b pduO Lr + kan + pTEV3 pET31b H 6 -tag, rTEV site at NdeI and Bpu1102I, MCS (NheI, NcoI EcoRI, XhoI, SacI, SmaI, BamHI, SacII, NotI, Bpu 1102I) bla + lacI + Escalante-Semerena lab collection pPDU22 pTEV3 pduO Lr + bla + Strains E. coli (JE3892) BL21( λ DE3) F − dcm impT hsdS (r B − m B − ) gal λ (DE3) New England Biolabs S. enterica a TR6583 metE205 ara-9 cobA + K. Sanderson via J. Roth JE1293 cobA366 ::Tn 10 d (cat + ) Escalante-Semerena Laboratory Collection JE8740 cobA366::Tn 10 d( cat + )/pCOBA17 Escalante-Semerena Laboratory Collection JE8741 cobA366 ::Tn 10 d( cat + )/pPDU19 Escalante-Semerena Laboratory Collection JE8742 cobA366 ::Tn 10 d (cat + )/pET15b Escalante-Semerena Laboratory Collection L. reuteri b Wild-type strain CRL1098 26 Open in a separate window a Derivatives of S. enterica serovar Typhimurium strain LT2. b CERELA stock collection, B 12 producer. caption a8 Strains and plasmids Unless otherwise stated, strains were constructed during the course of these studies.

Techniques: Construct

Journal: Applied and Environmental Microbiology

Article Title: Novel Characteristics of Succinate Coenzyme A (Succinate-CoA) Ligases: Conversion of Malate to Malyl-CoA and CoA-Thioester Formation of Succinate Analogues In Vitro

doi: 10.1128/AEM.03075-13

Figure Lengend Snippet: Strains, plasmids and oligonucleotides used in this study

Article Snippet: For maintenance of plasmids, solutions of antibiotics were prepared according to the method of Sambrook et al. ( 36 ) at the following concentrations: 100 μg/ml ampicillin [for cultivation of strains harboring the pET-23a(+) vector system], 150 μg/ml [for cultivation of strains harboring the pBluescriptSK(−) vector system], and 34 μg/ml chloramphenicol. table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Strain, plasmid, or oligonucleotide Description or sequence (5′–3′) a Source or reference Strains A. mimigardefordensis DPN7 Wild type, DTDP-degrading bacterium 30 (DSM 17166 T , LMG 22922 T ) A. mimigardefordensis DPN7 Δ sucCD sucCD deletion mutant of strain DPN7 26 E. coli Top10 F − mcrA Δ( mrr-hsdRMS-mcrBC ) ϕ80 lacZ ΔM15 Δ lacX74 nupG deoR recA1 araD139 Δ( ara-leu ) 7697 galU galK rpsL (Str r ) endA1 λ − Invitrogen, Carlsbad, CA E. coli S17-1 thi-1 proA hsdR17 (r K − m K + ) recA1 ; the tra gene of plasmid RP4 is integrated into the genome 42 E. coli BL21(DE3) pLysS F − ompT hsdS B (r B − m B − ) gal dcm (DE3)/pLysS (Cm r ) Novagen, Madison, WI Alcanivorax borkumensis SK2 Wild type DSM 11573 Plasmids pBluescriptSK(−) Ap r , lacPOZ ′ Stratagene, San Diego, CA pET-23a(+) pBR322 ori f1 ori His6 Ap r T7 lac Novagen, Madison, WI pBBR1MCS5 Broad-host-range expression vector, Gm r 45 pBluescriptSK(-):: sucCD Am Ap r 26 pBluescriptSK(-):: sucCD BL21 Ap r This study pET-23a(+):: sucCD Abo Ap r This study pET-23a(+):: sucCD AboHis Ap r This study pBBR1MCS5:: sucCD Am Gm r This study Oligonucleotides sucCDforward_PstI CTGCAG CAGTCTCAATTCGTGTGCTCGC 26 sucCDreverse_XhoI_stop CTCGAG TTACAGTACTGATTTGAGCAGTTTG 26 sucCDBL21_forward_EcoRI AAAA GAATTC TCCGACAAGCGATGCCTGATG suCDBL21_reverse_HindIII AAAA AAGCTT TTATTTCAGAACAGTTTTCAGTGCTTCACC sucCDAbo_forward_NdeI AAAA CATATG AATCTCCATGAATATCAGTCAAAACAGC sucCDAbo_reverse_SalI AAAA GTCGAC TTACCAGCCAGTCGCTTCTTTCAC P_Abo_rev_mutagenesis CCAGCCAGTCGCTTCTTTCAC (5′ phosphorylation) P_forward_XhoI_Histag_Abo CTCGAG CACCACCACCACC (5′ phosphorylation) SKF2 (Abo seq) TCTGAGCGCAGTGCTGG T7 terminator pET-23a GCTAGTTATTGCTCAGCGG T7 promoter pET-23a TAATACGACTCACTATAGGG For3 (BL21 seq) ACTTTTTGCCCGCTATGG For2 (BL21 seq) GTATCAAACAGATGCCAATGG Rev2 (BL21 seq) GTAGTGCCGCCTTTACCTG SucCDAm_Prom_fw_XhoI CTCGAG TTGCTGGTCACGCAGGAAGG Open in a separate window a For the abbreviations used in the E. coli genotypes, see reference 58 .

Techniques: Plasmid Preparation, Sequencing, Mutagenesis, Expressing

Journal: Applied and Environmental Microbiology

Article Title: Novel Characteristics of Succinate Coenzyme A (Succinate-CoA) Ligases: Conversion of Malate to Malyl-CoA and CoA-Thioester Formation of Succinate Analogues In Vitro

doi: 10.1128/AEM.03075-13

Figure Lengend Snippet: Purification of SucCD enzymes from E. coli BL21, A. mimigardefordensis DPN7 T , and A. borkumensis SK2

Article Snippet: For maintenance of plasmids, solutions of antibiotics were prepared according to the method of Sambrook et al. ( 36 ) at the following concentrations: 100 μg/ml ampicillin [for cultivation of strains harboring the pET-23a(+) vector system], 150 μg/ml [for cultivation of strains harboring the pBluescriptSK(−) vector system], and 34 μg/ml chloramphenicol. table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Strain, plasmid, or oligonucleotide Description or sequence (5′–3′) a Source or reference Strains A. mimigardefordensis DPN7 Wild type, DTDP-degrading bacterium 30 (DSM 17166 T , LMG 22922 T ) A. mimigardefordensis DPN7 Δ sucCD sucCD deletion mutant of strain DPN7 26 E. coli Top10 F − mcrA Δ( mrr-hsdRMS-mcrBC ) ϕ80 lacZ ΔM15 Δ lacX74 nupG deoR recA1 araD139 Δ( ara-leu ) 7697 galU galK rpsL (Str r ) endA1 λ − Invitrogen, Carlsbad, CA E. coli S17-1 thi-1 proA hsdR17 (r K − m K + ) recA1 ; the tra gene of plasmid RP4 is integrated into the genome 42 E. coli BL21(DE3) pLysS F − ompT hsdS B (r B − m B − ) gal dcm (DE3)/pLysS (Cm r ) Novagen, Madison, WI Alcanivorax borkumensis SK2 Wild type DSM 11573 Plasmids pBluescriptSK(−) Ap r , lacPOZ ′ Stratagene, San Diego, CA pET-23a(+) pBR322 ori f1 ori His6 Ap r T7 lac Novagen, Madison, WI pBBR1MCS5 Broad-host-range expression vector, Gm r 45 pBluescriptSK(-):: sucCD Am Ap r 26 pBluescriptSK(-):: sucCD BL21 Ap r This study pET-23a(+):: sucCD Abo Ap r This study pET-23a(+):: sucCD AboHis Ap r This study pBBR1MCS5:: sucCD Am Gm r This study Oligonucleotides sucCDforward_PstI CTGCAG CAGTCTCAATTCGTGTGCTCGC 26 sucCDreverse_XhoI_stop CTCGAG TTACAGTACTGATTTGAGCAGTTTG 26 sucCDBL21_forward_EcoRI AAAA GAATTC TCCGACAAGCGATGCCTGATG suCDBL21_reverse_HindIII AAAA AAGCTT TTATTTCAGAACAGTTTTCAGTGCTTCACC sucCDAbo_forward_NdeI AAAA CATATG AATCTCCATGAATATCAGTCAAAACAGC sucCDAbo_reverse_SalI AAAA GTCGAC TTACCAGCCAGTCGCTTCTTTCAC P_Abo_rev_mutagenesis CCAGCCAGTCGCTTCTTTCAC (5′ phosphorylation) P_forward_XhoI_Histag_Abo CTCGAG CACCACCACCACC (5′ phosphorylation) SKF2 (Abo seq) TCTGAGCGCAGTGCTGG T7 terminator pET-23a GCTAGTTATTGCTCAGCGG T7 promoter pET-23a TAATACGACTCACTATAGGG For3 (BL21 seq) ACTTTTTGCCCGCTATGG For2 (BL21 seq) GTATCAAACAGATGCCAATGG Rev2 (BL21 seq) GTAGTGCCGCCTTTACCTG SucCDAm_Prom_fw_XhoI CTCGAG TTGCTGGTCACGCAGGAAGG Open in a separate window a For the abbreviations used in the E. coli genotypes, see reference 58 .

Techniques: Purification, Activity Assay

Journal: Applied and Environmental Microbiology

Article Title: Novel Characteristics of Succinate Coenzyme A (Succinate-CoA) Ligases: Conversion of Malate to Malyl-CoA and CoA-Thioester Formation of Succinate Analogues In Vitro

doi: 10.1128/AEM.03075-13

Figure Lengend Snippet: Kinetic parameters determined for SucCD BL21 , SucCD Am , and SucCD AboHis a

Article Snippet: For maintenance of plasmids, solutions of antibiotics were prepared according to the method of Sambrook et al. ( 36 ) at the following concentrations: 100 μg/ml ampicillin [for cultivation of strains harboring the pET-23a(+) vector system], 150 μg/ml [for cultivation of strains harboring the pBluescriptSK(−) vector system], and 34 μg/ml chloramphenicol. table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Strain, plasmid, or oligonucleotide Description or sequence (5′–3′) a Source or reference Strains A. mimigardefordensis DPN7 Wild type, DTDP-degrading bacterium 30 (DSM 17166 T , LMG 22922 T ) A. mimigardefordensis DPN7 Δ sucCD sucCD deletion mutant of strain DPN7 26 E. coli Top10 F − mcrA Δ( mrr-hsdRMS-mcrBC ) ϕ80 lacZ ΔM15 Δ lacX74 nupG deoR recA1 araD139 Δ( ara-leu ) 7697 galU galK rpsL (Str r ) endA1 λ − Invitrogen, Carlsbad, CA E. coli S17-1 thi-1 proA hsdR17 (r K − m K + ) recA1 ; the tra gene of plasmid RP4 is integrated into the genome 42 E. coli BL21(DE3) pLysS F − ompT hsdS B (r B − m B − ) gal dcm (DE3)/pLysS (Cm r ) Novagen, Madison, WI Alcanivorax borkumensis SK2 Wild type DSM 11573 Plasmids pBluescriptSK(−) Ap r , lacPOZ ′ Stratagene, San Diego, CA pET-23a(+) pBR322 ori f1 ori His6 Ap r T7 lac Novagen, Madison, WI pBBR1MCS5 Broad-host-range expression vector, Gm r 45 pBluescriptSK(-):: sucCD Am Ap r 26 pBluescriptSK(-):: sucCD BL21 Ap r This study pET-23a(+):: sucCD Abo Ap r This study pET-23a(+):: sucCD AboHis Ap r This study pBBR1MCS5:: sucCD Am Gm r This study Oligonucleotides sucCDforward_PstI CTGCAG CAGTCTCAATTCGTGTGCTCGC 26 sucCDreverse_XhoI_stop CTCGAG TTACAGTACTGATTTGAGCAGTTTG 26 sucCDBL21_forward_EcoRI AAAA GAATTC TCCGACAAGCGATGCCTGATG suCDBL21_reverse_HindIII AAAA AAGCTT TTATTTCAGAACAGTTTTCAGTGCTTCACC sucCDAbo_forward_NdeI AAAA CATATG AATCTCCATGAATATCAGTCAAAACAGC sucCDAbo_reverse_SalI AAAA GTCGAC TTACCAGCCAGTCGCTTCTTTCAC P_Abo_rev_mutagenesis CCAGCCAGTCGCTTCTTTCAC (5′ phosphorylation) P_forward_XhoI_Histag_Abo CTCGAG CACCACCACCACC (5′ phosphorylation) SKF2 (Abo seq) TCTGAGCGCAGTGCTGG T7 terminator pET-23a GCTAGTTATTGCTCAGCGG T7 promoter pET-23a TAATACGACTCACTATAGGG For3 (BL21 seq) ACTTTTTGCCCGCTATGG For2 (BL21 seq) GTATCAAACAGATGCCAATGG Rev2 (BL21 seq) GTAGTGCCGCCTTTACCTG SucCDAm_Prom_fw_XhoI CTCGAG TTGCTGGTCACGCAGGAAGG Open in a separate window a For the abbreviations used in the E. coli genotypes, see reference 58 .

Techniques:

Journal: BMC Genomics

Article Title: Genome re-sequencing and reannotation of the Escherichia coli ER2566 strain and transcriptome sequencing under overexpression conditions

doi: 10.1186/s12864-020-06818-1

Figure Lengend Snippet: Flowchart depicting the pipeline and methods used for bacterial genome reannotation of the E. coli strain ER2566

Article Snippet: The E. coli B Strain ER2566 was purchased from New England Biolabs (NEB).

Techniques:

Journal: BMC Genomics

Article Title: Genome re-sequencing and reannotation of the Escherichia coli ER2566 strain and transcriptome sequencing under overexpression conditions

doi: 10.1186/s12864-020-06818-1

Figure Lengend Snippet: Comparison between BL21(DE3) genome and ER2566 genome. Viewing from outside to inside rings, the outermost two rings, respectively representing plus-strand and minus-strand, show features extracted from the BL21(DE3) genome GenBank file (GenBank: CP001509.3); the next ring shows the positions of BLAST hits between the BL21(DE3) genome and the ER2566 genome detected by Blastn. The height of each line in the third ring showing BLAST results is proportional to the percent identity of the hit, and overlapping hits renders as darker lines. The next two rings show GC content and GC skew

Article Snippet: The E. coli B Strain ER2566 was purchased from New England Biolabs (NEB).

Techniques:

Journal: Applied and Environmental Microbiology

Article Title: Application of a Euryarchaeota -Specific Helicase from Thermococcus kodakarensis for Noise Reduction in PCR

doi: 10.1128/AEM.04116-15

Figure Lengend Snippet: Strains and primers used in this study

Article Snippet: Ampicillin (50 μg · ml −1 ), kanamycin (20 μg · ml −1 ), and/or chloramphenicol (25 μg · ml −1 ) was added to the medium when needed. table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Strain or primer Relevant characteristic(s) or sequence (5′ to 3′) a Source or reference Strains E. coli DH5α F − ϕ80d lacZ ΔM15 Δ( lacZYA-argF ) U169 deoR recA1 endA1 hsdR 17 (r K − m K + ) phoA supE 44 λ − thi-1 gyrA 96 relA 1 Stratagene BL21-CodonPlus(DE3)-RIL E. coli B F − ompT hsdS (r B − m B − ) dcm + Tet r gal λ (DE3) endA Hte [ argU ileY leuW Cam r ] Stratagene Primers tk0566-Fw AAAAAACATATG CTCTTCGTCGTGAGACCGGGA This study tk0566-Rv TTTGAATTC TTAGCGTATCATCCTCCCTTCTTCTA This study tk0928-Fw AAAAAAACATATG ATGGTTGTCCTGAGAATCCC This study tk0928-Rv AAAAGTCGAC TTAACTAGAGCGGCGCTTTTTGG This study TK0566-D344A-E345A Fw GGAACCATAGTGATA GCCGCC ATACACACGCTCGAC This study TK0566-D344A-E345A Rv GTCGAGCGTGTGTAT GGCGGC TATCACTATGGTTCC This study 16S rRNA gene Fw ATTCCGGTTGATCCTGCCGGAGGCCACTGC This study 16S rRNA gene Rv TCCGGCGATAGGAGGTGATCGAGCCGTAGG This study toxA Fw ATGCACCTGACACCCCATTG This study toxA Rv TTACTTCAGGTCCTCGCGCG This study 16 S miss 5′ Rv ATGGA GGCGAGCTCGAAGCTCGCCCGACAC This study 16 S miss 3′ Rv GGCGAGCTCGAAGCTCGCCCGACAC AGCTA This study Open in a separate window a Mismatched nucleotides within the sequences of the 16S rRNA, Tk0566 , or Tk0928 gene are underlined.

Techniques: Sequencing

Journal:

Article Title: Induction of Manganese-Containing Superoxide Dismutase Is Required for Acid Tolerance in Vibrio vulnificus

doi: 10.1128/JB.187.17.5984-5995.2005

Figure Lengend Snippet: Bacterial strains and plasmids used in this study

Article Snippet: If the A 600 of the V. vulnificus culture was larger than 0.7, it was diluted prior to measurement. table ft1 table-wrap mode="anchored" t5 TABLE 1. caption a7 Strain or plasmid Relevant characteristic(s) Reference or source Bacterial strains V. vulnificus ATCC 29307 Type strain 21 AR ATCO 29307, Rif r 23 HLM101 MO6-24/O, Δ fur, fur :: aph ; Km r 23 FSA1 MO6-24/O, Δ fur , Δ sodA ; Km r This study KPR101 AR, Δ rpoS 37 SA1 AR, sodA :: aph ; Km r This study SB1 AR, sodB :: aph ; Km r This study SC1 AR, sodC :: aph ; Km r This study SR1 AR, soxR :: aph ; Km r This study JR203 ATCC 29307, cadA :: npt ; Km r 40 E. coli DH5α supE 44 Δ lacU 169 (φ80 lacZ ΔM15) hsdR 17 recA 1 endA 1 gyrA 96 thi -1 relA 1 12 S17-1 C600::RP4 2-(Tc::Mu)(Km::Tn 7 ) thi pro hsdR hsdM + recA 46 S17-1λ pir λ pir lysogen of S17-1 46 BL21(DE3) E. coli B F − dcm ompT hsdS (r B − m B − ) gal λ(DE3) Stratagene Plasmids pRK415 ori IncP Mob RP4 lacZa ; Tc r 16 pSODAC pRK415 + sodA :: cat fusion; Tc r This study pDM4 ori R6K Mob RP4; Cm r 32 pDMSAKm pDM4 + 3.0-kb fragment containing sodA :: aph ; Km r , Cm r This study pDMSAid pDM4 + Δ sodA ; 0.6-kb Xba I- Xho I fragment of pSAid; internally deleted ( Bgl II- Stu I) from sodA ; Cm r This study pDMSB pDM4 + 3.1-kb fragment containing sodB :: aph ; Km r , Cm r This study pDMSC pDM4 + 3.1-kb fragment containing sodC :: aph ; Km r , Cm r This study pDMSXR pDM4 + 2.8-kb fragment containing soxR :: aph ; Km r , Cm r This study pRKSA pRK415 + 0.8-kb fragment containing sodA ; Tc r This study pRKSB pRK415 + 0.8-kb fragment containing sodB ; Tc r This study pRKSC pRK415 + 1.1-kb fragment containing sodC ; Tc r This study Open in a separate window Bacterial strains and plasmids used in this study For growth transition, cells were first grown in LBS (pH 7.5) with sufficient aeration (35-ml culture in 300-ml flask at 250-rpm shake) up to logarithmic growth phase ( A 600 , ∼2.0).

Techniques: Plasmid Preparation

Journal:

Article Title: Characterization of Virulence Factor Regulation by SrrAB, a Two-Component System in Staphylococcus aureus

doi: 10.1128/JB.186.8.2430-2438.2004

Figure Lengend Snippet: Bacterial strains and plasmids used in this study

Article Snippet: All strains were grown in a laboratory aerobic atmosphere with shaking. table ft1 table-wrap mode="anchored" t5 TABLE 1. caption a7 Strain or plasmid Relevant characteristics Source and/or reference E. coli BL21(DE3) B F − dcm ompT hsdS (r B − m B − ) gal λ (DE3) Stratagene S. aureus strains MN8 tstH 1 RN4220 8325-4 r K − m K + 16 MN3050 RN4220(pJMY10) tstH + 37 MN4011 RN4220 srrB ΩpJMY2 Em r (pJMY11) tstH + srrAB + 37 DU5875 8325-4 Δ spa ::Tc r , Tc r T. Foster ( 20 ) DU5875(pJMY11) DU5875(pJMY11), Tc r Cm r This study RN6390 8325-4 R. Novick ( 23 ) RN6390(pJMY10) 8325-4(pJMY10), Cm r This study RN6390(pJMY11) 8325-4(pJMY11), Cm r This study Plasmids pJMY10 805-bp Cm r cassette from pIJ002 cloned into the PstI and ScaI sites of pCE107, tstH , 5.4 kb, Cm r 37 pJMY11 2,712-bp srrAB operon cloned into the XmaI site of pJMY10, tstH srrAB , 8.2 kb, Cm r 37 pJMY21 402-bp portion of srrB (SrrB*) cloned into NheI-BamHI sites of pET28b This study pJMY22 726-bp full-length srrA cloned into NheI-BamHI sites of pET28b This study Open in a separate window Bacterial strains and plasmids used in this study Generation of anti-SrrA and anti-SrrB* antibodies.

Techniques: Plasmid Preparation, Clone Assay

Journal:

Article Title: Characterization of Virulence Factor Regulation by SrrAB, a Two-Component System in Staphylococcus aureus

doi: 10.1128/JB.186.8.2430-2438.2004

Figure Lengend Snippet: Subcellular localization of SrrA and SrrB. (A) rSrrA and rSrrB* were produced by independently cloning the full-length srrA gene and the putative extracellular portion of the srrB gene into the pET28b expression vector. E. coli strains BL21(pJMY22) and BL21(pJMY21) containing the pET28b-SrrA and pET28b-SrrB* constructs, respectively, were grown in Luria-Bertani medium, induced to express recombinant protein, and harvested by centrifugation. Recombinant protein was obtained as described in Materials and Methods. The recombinant histidine-tagged proteins were purified by column chromatography. The histidine tag was removed from SrrA by thrombin cleavage, and both proteins were purified by HPLC. rSrrA was present as an approximately 34-kDa protein on an SDS-polyacrylamide gel, while rSrrB* was present as an approximately 18-kDa protein. (B) S. aureus strains DU5875 and DU5875(pJMY11) were grown to the postexponential phase, lysed, and separated into membrane and cytoplasmic fractions as described in the text. Fractions were electrophoresed by SDS-PAGE and blotted for Western analysis. Cytoplasmic fractions are on the left and membrane fractions are on the right of each blot. (Left panel) Western blot with anti-SrrA (α-SrrA). SrrA was present as an approximately 34-kDa protein that was in the cytoplasmic fraction of strain DU5875(pJMY11). (Center panel) Western blot with anti-SrrB* (α-SrrB*). SrrB was present as an approximately 60-kDa protein that was in both the DU5875 and DU5875(pJMY11) membrane fractions. (Right panel) Western blot with normal serum. Numbers on the left are molecular masses, in kilodaltons.

Article Snippet: All strains were grown in a laboratory aerobic atmosphere with shaking. table ft1 table-wrap mode="anchored" t5 TABLE 1. caption a7 Strain or plasmid Relevant characteristics Source and/or reference E. coli BL21(DE3) B F − dcm ompT hsdS (r B − m B − ) gal λ (DE3) Stratagene S. aureus strains MN8 tstH 1 RN4220 8325-4 r K − m K + 16 MN3050 RN4220(pJMY10) tstH + 37 MN4011 RN4220 srrB ΩpJMY2 Em r (pJMY11) tstH + srrAB + 37 DU5875 8325-4 Δ spa ::Tc r , Tc r T. Foster ( 20 ) DU5875(pJMY11) DU5875(pJMY11), Tc r Cm r This study RN6390 8325-4 R. Novick ( 23 ) RN6390(pJMY10) 8325-4(pJMY10), Cm r This study RN6390(pJMY11) 8325-4(pJMY11), Cm r This study Plasmids pJMY10 805-bp Cm r cassette from pIJ002 cloned into the PstI and ScaI sites of pCE107, tstH , 5.4 kb, Cm r 37 pJMY11 2,712-bp srrAB operon cloned into the XmaI site of pJMY10, tstH srrAB , 8.2 kb, Cm r 37 pJMY21 402-bp portion of srrB (SrrB*) cloned into NheI-BamHI sites of pET28b This study pJMY22 726-bp full-length srrA cloned into NheI-BamHI sites of pET28b This study Open in a separate window Bacterial strains and plasmids used in this study Generation of anti-SrrA and anti-SrrB* antibodies.

Techniques: Produced, Clone Assay, Expressing, Plasmid Preparation, Construct, Recombinant, Centrifugation, Purification, Column Chromatography, SDS Page, Western Blot